128239_K63, 128239_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name128239_K63
Genbank IDKP279164
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)19
Primer 1128239_K63.forward primer: AAATAACGATGGCTACATCC
Primer 2128239_K63.reverse primer: GTTTGTTGATGACAATCCTG
Max Length207
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279164
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG1N/A10.15128239_K63View
2Cranberry-Mullica_Queen-2007LG1N/A11.6128239_K63View
3Cranberry-CNJ02-1-2017LG01N/A9.2128239_K63View
4Cranberry-Mullica_Queen-2017LG01N/A10.1128239_K63View