162108_K70, 162108_K70 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name162108_K70
Genbank IDKP279200
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)15
Primer 1162108_K70.forward primer: GAAGTCGAAACCCTAGCAG
Primer 2162108_K70.reverse primer: GTCCCTCTCAGTCTCTCACTC
Max Length318
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2007LG1N/A69.76162108_K70ViewN/A
2Cranberry-Mullica_Queen-2007LG1N/A80.4162108_K70ViewN/A
3Cranberry-CNJ02-1-2017LG01N/A66.2162108_K70ViewN/A
4Cranberry-Mullica_Queen-2017LG01N/A77.5162108_K70ViewN/A
5Cranberry-Crimson_Queen-2007LG1N/A59.4162108_K70ViewN/A
6Cranberry-Crimson_Queen-2017LG01N/A56.4162108_K70ViewN/A
7Cranberry-Composite_map-F1LG01N/A40.72162108_K70ViewN/A
8Cranberry-Crimson_Queen-F1LG01N/A21.44162108_K70ViewN/A
9Cranberry-Mullica_Queen_1-F1LG01N/A22.65162108_K70ViewN/A
10Cranberry-Mullica_Queen_2-F1LG01N/A53.97162108_K70ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279200
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer162108_K70.forward primerVaccinium macrocarponprimer
reverse primer162108_K70.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
162108_K70162108_K70Vaccinium macrocarponmarker_locus
162108_K70162108_K70-40.72Vaccinium macrocarponmarker_locus
162108_K70162108_K70-21.44Vaccinium macrocarponmarker_locus
162108_K70162108_K70-22.65Vaccinium macrocarponmarker_locus
162108_K70162108_K70-53.97Vaccinium macrocarponmarker_locus