162108_K70, 162108_K70 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name162108_K70
Genbank IDKP279200
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)15
Primer 1162108_K70.forward primer: GAAGTCGAAACCCTAGCAG
Primer 2162108_K70.reverse primer: GTCCCTCTCAGTCTCTCACTC
Max Length318
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279200
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
Vmac_chr01supercontigVmac_chr01:26936747..26937008 .Vaccinium macrocarpon cv. Ben Lear v1.0 genome sequenceGDV marker alignment to genome using primer sequences
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG1N/A69.76162108_K70View
2Cranberry-Crimson_Queen-2007LG1N/A59.4162108_K70View
3Cranberry-Mullica_Queen-2007LG1N/A80.4162108_K70View
4Cranberry-CNJ02-1-2017LG01N/A66.2162108_K70View
5Cranberry-Crimson_Queen-2017LG01N/A56.4162108_K70View
6Cranberry-Mullica_Queen-2017LG01N/A77.5162108_K70View
7Cranberry-Composite_map-F1LG01N/A40.72162108_K70View
8Cranberry-Crimson_Queen-F1LG01N/A21.44162108_K70View
9Cranberry-Mullica_Queen_1-F1LG01N/A22.65162108_K70View
10Cranberry-Mullica_Queen_2-F1LG01N/A53.97162108_K70View