172672_K70, 172672_K70 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name172672_K70
Genbank IDKP279201
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)16
Primer 1172672_K70.forward primer: GATAGTTGTATGCGCTGTAAGA
Primer 2172672_K70.reverse primer: GTTACCCGAATGAACAGGT
Max Length356
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Blueberry-F1#10-2017LG02N/A13.3172672_K70View
2Cranberry-Mullica_Queen-2007LG2N/A53.9172672_K70View
3Cranberry-Crimson_Queen-2007LG2N/A45172672_K70View
4Blueberry-W85-23-2017LG02N/A47.5172672_K70View
5Blueberry-F1#10_x_W85-23-F1-2017LG02N/A48.7172672_K70View
6Cranberry-CNJ02-1-2017LG02N/A47.4172672_K70View
7Cranberry-Mullica_Queen-2017LG02N/A50.5172672_K70View
8Cranberry-CNJ02-1-2007LG2N/A49.07172672_K70View
9Cranberry-Crimson_Queen-2017LG02N/A41.5172672_K70View
10Cranberry-Composite_map-F1LG02N/A54.75172672_K70View
11Cranberry-Crimson_Queen-F1LG02N/A57.25172672_K70View
12Cranberry-Mullica_Queen_1-F1LG02N/A65.28172672_K70View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279201
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer172672_K70.forward primerVaccinium macrocarponprimer
reverse primer172672_K70.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
172672_K70172672_K70Vaccinium macrocarponmarker_locus
172672_K70172672_K70-54.75Vaccinium macrocarponmarker_locus
172672_K70172672_K70-57.25Vaccinium macrocarponmarker_locus
172672_K70172672_K70-65.28Vaccinium macrocarponmarker_locus