1trimcontig175770, 1trimcontig175770 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name1trimcontig175770
Genbank IDKP279220
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)16
Primer 11trimcontig175770.forward primer: GTGTAGCTTGGAAAATAGGAGT
Primer 21trimcontig175770.reverse primer: ACTAGGGAGCGAGAGAGAGTA
Max Length346
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2017LG12N/A87.11trimcontig175770View
2Cranberry-CNJ02-1-2017LG12N/A71.81trimcontig175770View
3Cranberry-Mullica_Queen_1-F1LG12N/A01trimcontig175770View
4Cranberry-CNJ02-1-2007LG12N/A80.351trimcontig175770View
5Cranberry-Stevens-F1LG12N/A01trimcontig175770View
6Cranberry-Crimson_Queen-2017LG12N/A59.11trimcontig175770View
7Cranberry-Crimson_Queen-F1LG12N/A01trimcontig175770View
8Cranberry-Crimson_Queen-2007LG12N/A69.11tc175770View
9Cranberry-Mullica_Queen-2007LG12N/A98.91tc175770View
10Cranberry-Composite_map-F1LG12N/A2.841trimcontig175770View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279220
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer1trimcontig175770.forward primerVaccinium macrocarponprimer
reverse primer1trimcontig175770.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
1trimcontig1757701trimcontig175770Vaccinium macrocarponmarker_locus
1tc1757701tc175770Vaccinium macrocarponmarker_locus
1trimcontig1757701trimcontig175770-2.84Vaccinium macrocarponmarker_locus