2ms2a02, 2ms2a02 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	2ms2a02
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	2ms2a02.forward primer: ACCGCAAGAGAGAGATTCCA
Primer 2	2ms2a02.reverse primer: GTTTGATGATCACGGTGGTG
Publication	[view all]

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG5	N/A	10.4	2ms2a02	View
2	Cranberry-Mullica_Queen_2-F1	LG03	N/A	0	2ms2a02	View
3	Cranberry-Composite_map-F1	LG03	N/A	6.52	2ms2a02	View
4	Cranberry-BB/CQ-F1	LG05	N/A	84.05	2ms2a02	View