242569_K70, 242569_K70 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name242569_K70
Genbank IDKP279204
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)15
Primer 1242569_K70.forward primer: GATATGAGAGACGAGGAATCAC
Primer 2242569_K70.reverse primer: GTCAGTGGACGGTTTTAAGAT
Max Length308
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Crimson_Queen-2007LG1N/A49242569_K70ViewN/A
2Cranberry-Crimson_Queen-2017LG01N/A46.2242569_K70ViewN/A
3Cranberry-CNJ02-1-2017LG01N/A53.6242569_K70ViewN/A
4Cranberry-Mullica_Queen-2017LG01N/A61.8242569_K70ViewN/A
5Cranberry-CNJ02-1-2007LG1N/A55.9242569_K70ViewN/A
6Cranberry-Mullica_Queen-2007LG1N/A62.5242569_K70ViewN/A
7Cranberry-Composite_map-F1LG01N/A55.3242569_K70ViewN/A
8Cranberry-Crimson_Queen-F1LG01N/A32.78242569_K70ViewN/A
9Cranberry-GH1/35-F1LG01N/A53.68242569_K70ViewN/A
10Cranberry-Mullica_Queen_1-F1LG01N/A39.32242569_K70ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279204
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer242569_K70.forward primerVaccinium macrocarponprimer
reverse primer242569_K70.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
242569_K70242569_K70Vaccinium macrocarponmarker_locus
242569_K70242569_K70-55.3Vaccinium macrocarponmarker_locus
242569_K70242569_K70-32.78Vaccinium macrocarponmarker_locus
242569_K70242569_K70-53.68Vaccinium macrocarponmarker_locus
242569_K70242569_K70-39.32Vaccinium macrocarponmarker_locus