242569_K70, 242569_K70 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Genbank IDKP279204
SpeciesVaccinium macrocarpon
Repeat Motif(AG)15
Primer 1242569_K70.forward primer: GATATGAGAGACGAGGAATCAC
Primer 2242569_K70.reverse primer: GTCAGTGGACGGTTTTAAGAT
Max Length308
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
External references for this genetic_marker

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer242569_K70.forward primerVaccinium macrocarponprimer
reverse primer242569_K70.reverse primerVaccinium macrocarponprimer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
242569_K70242569_K70Vaccinium macrocarponmarker_locus
242569_K70242569_K70-55.3Vaccinium macrocarponmarker_locus
242569_K70242569_K70-32.78Vaccinium macrocarponmarker_locus
242569_K70242569_K70-53.68Vaccinium macrocarponmarker_locus
242569_K70242569_K70-39.32Vaccinium macrocarponmarker_locus