247873_K63, 247873_K63 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	247873_K63
Genbank ID	KP279258
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TC)15
Primer 1	247873_K63.forward primer: GATCGGAGAGTTTTCCTCTT
Primer 2	247873_K63.reverse primer: CAATTTCCTTCCCCAACTAT
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279258

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr03	supercontig	Vmac_chr03:4244394..4244796 .
chr3	supercontig	chr3:4289144..4289550 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.