309124_K70, 309124_K70 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name309124_K70
Genbank IDKP279213
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)15
Primer 1309124_K70.forward primer: AAAGGTCGTTAAGGCTATCAG
Primer 2309124_K70.reverse primer: TGATGACTGCGATATGTACTCT
Max Length177
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG09N/A37.5309124_K70View
2Cranberry-Crimson_Queen-2017LG09N/A31.5309124_K70View
3Cranberry-CNJ02-1-2007LG9N/A42.46309124_K70View
4Cranberry-Crimson_Queen-2007LG9N/A39.6309124_K70View
5Cranberry-Mullica_Queen-2007LG9N/A51.9309124_K70View
6Cranberry-Mullica_Queen-2017LG09N/A44309124_K70View
7Cranberry-Composite_map-F1LG09N/A56.79309124_K70View
8Cranberry-Crimson_Queen-F1LG09N/A39.98309124_K70View
9Cranberry-Mullica_Queen_1-F1LG09N/A59.04309124_K70View
10Cranberry-Mullica_Queen_2-F1LG09N/A53.59309124_K70View
11Cranberry-Stevens-F1LG09N/A48.59309124_K70View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279213
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer309124_K70.forward primerVaccinium macrocarponprimer
reverse primer309124_K70.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
309124_K70309124_K70Vaccinium macrocarponmarker_locus
309124_K70309124_K70-56.79Vaccinium macrocarponmarker_locus
309124_K70309124_K70-39.98Vaccinium macrocarponmarker_locus
309124_K70309124_K70-59.04Vaccinium macrocarponmarker_locus
309124_K70309124_K70-53.59Vaccinium macrocarponmarker_locus
309124_K70309124_K70-48.59Vaccinium macrocarponmarker_locus