76126_K63, 76126_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name76126_K63
Genbank IDKP279162
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)16
Primer 176126_K63.forward primer: TTTATTGGAGCGAAAGAGAG
Primer 276126_K63.reverse primer: AAAAGGGGAGGAGAGAGAT
Max Length242
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2017LG12N/A35.876126_K63View
2Cranberry-CNJ02-1-2017LG12N/A2876126_K63View
3Cranberry-Crimson_Queen-2017LG12N/A19.876126_K63View
4Cranberry-Crimson_Queen-2007LG12N/A26.376126_K63View
5Cranberry-CNJ02-1-2007LG12N/A30.7876126_K63View
6Cranberry-Mullica_Queen-2007LG12N/A38.576126_K63View
7Cranberry-Composite_map-F1LG12N/A61.7976126_K63View
8Cranberry-Crimson_Queen-F1LG12N/A42.4276126_K63View
9Cranberry-Mullica_Queen_1-F1LG12N/A65.0376126_K63View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279162
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer76126_K63.forward primerVaccinium macrocarponprimer
reverse primer76126_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
76126_K6376126_K63Vaccinium macrocarponmarker_locus
76126_K6376126_K63-61.79Vaccinium macrocarponmarker_locus
76126_K6376126_K63-42.42Vaccinium macrocarponmarker_locus
76126_K6376126_K63-65.03Vaccinium macrocarponmarker_locus