314402_K70, 314402_K70 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	314402_K70
Genbank ID	KP279217
Type	EST-SSR
Species	Vaccinium macrocarpon
Repeat Motif	(GA)17
Primer 1	314402_K70.forward primer: TGGAAGAACTCGATACGAAC
Primer 2	314402_K70.reverse primer: GAGAAGTTGGATACTGGAAATG
Max Length	170
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279217

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr11	supercontig	Vmac_chr11:2044829..2044983 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.