372875_K63, 372875_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name372875_K63
Genbank IDKP279174
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)18
Primer 1372875_K63.forward primer: CACACACAAATCCCAATTTC
Primer 2372875_K63.reverse primer: GATGGTGTTTTCATAGTTCGAC
Max Length228
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Crimson_Queen-2007LG2N/A57.8372875_K63ViewN/A
2Blueberry-F1#10_x_W85-23-F1-2017LG02N/A57372875_K63ViewN/A
3Cranberry-Crimson_Queen-2017LG02N/A59.5372875_K63ViewN/A
4Cranberry-CNJ02-1-2007LG2N/A66.03372875_K63ViewN/A
5Blueberry-F1#10-2017LG02N/A23372875_K63ViewN/A
6Cranberry-CNJ02-1-2017LG02N/A66.4372875_K63ViewN/A
7Cranberry-Mullica_Queen-2017LG02N/A72.1372875_K63ViewN/A
8Cranberry-Mullica_Queen-2007LG2N/A75.8372875_K63ViewN/A
9Blueberry-W85-23-2017LG02N/A55.9372875_K63ViewN/A
10Cranberry-Composite_map-F1LG02N/A34.75372875_K63ViewN/A
11Cranberry-Crimson_Queen-F1LG02N/A41.73372875_K63ViewN/A
12Cranberry-Mullica_Queen_1-F1LG02N/A42.51372875_K63ViewN/A
13Cranberry-Mullica_Queen_2-F1LG02N/A49.55372875_K63ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279174
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer372875_K63.forward primerVaccinium macrocarponprimer
reverse primer372875_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
372875_K63372875_K63Vaccinium macrocarponmarker_locus
372875_K63372875_K63-34.75Vaccinium macrocarponmarker_locus
372875_K63372875_K63-41.73Vaccinium macrocarponmarker_locus
372875_K63372875_K63-42.51Vaccinium macrocarponmarker_locus
372875_K63372875_K63-49.55Vaccinium macrocarponmarker_locus