314761_K63, 314761_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name314761_K63
Genbank IDKP279170
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)14
Primer 1314761_K63.forward primer: :ATTGTTGGATACTTCATGGC
Primer 2314761_K63.reverse primer: GTTGGTACTGGTAAACCCTAAT
Max Length197
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Composite_map-F1LG02N/A14.83314761_K63ViewN/A
2Cranberry-Mullica_Queen_1-F1LG02N/A19.83314761_K63ViewN/A
3Cranberry-Mullica_Queen_2-F1LG02N/A22.65314761_K63ViewN/A
4Cranberry-Stevens-F1LG02N/A11.95314761_K63ViewN/A
5Cranberry-CNJ02-1-2017LG02N/A81.1314761_K63ViewN/A
6Cranberry-Mullica_Queen-2017LG02N/A91.5314761_K63ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279170
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer314761_K63.forward primerVaccinium macrocarponprimer
reverse primer314761_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
314761_K63314761_K63-14.83Vaccinium macrocarponmarker_locus
314761_K63314761_K63-19.83Vaccinium macrocarponmarker_locus
314761_K63314761_K63-22.65Vaccinium macrocarponmarker_locus
314761_K63314761_K63-11.95Vaccinium macrocarponmarker_locus
314761_K63314761_K63Vaccinium macrocarponmarker_locus