35137_K63, 35137_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name35137_K63
Genbank IDKP279254
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)14
Primer 135137_K63.forward primer: GGAACATCAAAACTCCCATAC
Primer 235137_K63.reverse primer: GTTCTTCCCCATTTCAGTAAGT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Composite_map-F1LG02N/A54.4735137_K63ViewN/A
2Cranberry-Mullica_Queen_2-F1LG02N/A63.0135137_K63ViewN/A
3Cranberry-Stevens-F1LG02N/A44.8735137_K63ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279254
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer35137_K63.forward primerVaccinium macrocarponprimer
reverse primer35137_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
35137_K6335137_K63-54.47Vaccinium macrocarponmarker_locus
35137_K6335137_K63-63.01Vaccinium macrocarponmarker_locus
35137_K6335137_K63-44.87Vaccinium macrocarponmarker_locus