80734_K70, 80734_K70 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name80734_K70
Genbank IDKP279198
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)15
Primer 180734_K70.forward primer: AGGGAGAACCAATTCCTTAC
Primer 280734_K70.reverse primer: GACCTAACCCTAACCCAGTC
Max Length373
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG7N/A59.980734_K70View
2Cranberry-Crimson_Queen-2017LG07N/A49.580734_K70View
3Cranberry-Mullica_Queen-2017LG07N/A53.480734_K70View
4Cranberry-CNJ02-1-2017LG07N/A50.680734_K70View
5Cranberry-Crimson_Queen-2007LG7N/A51.980734_K70View
6Cranberry-CNJ02-1-2007LG7N/A55.6680734_K70View
7Cranberry-Composite_map-F1LG07N/A41.8380734_K70View
8Cranberry-Crimson_Queen-F1LG07N/A39.3280734_K70View
9Cranberry-Mullica_Queen_1-F1LG07N/A50.180734_K70View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279198
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer80734_K70.forward primerVaccinium macrocarponprimer
reverse primer80734_K70.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
80734_K7080734_K70Vaccinium macrocarponmarker_locus
80734_K7080734_K70-41.83Vaccinium macrocarponmarker_locus
80734_K7080734_K70-39.32Vaccinium macrocarponmarker_locus
80734_K7080734_K70-50.1Vaccinium macrocarponmarker_locus