416815_K63, 416815_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name416815_K63
Genbank IDKP279186
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)17
Primer 1416815_K63.forward primer: CGTTTCTTTTCTTCTCTCTCTC
Primer 2416815_K63.reverse primer: CCTCCATTCTCTCTCCTACTAA
Max Length252
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279186
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer416815_K63.forward primerVaccinium macrocarponprimer
reverse primer416815_K63.reverse primerVaccinium macrocarponprimer