ct119523, ct119523 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect119523
Genbank IDKP279114
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)11
Primer 1ct119523.forward primer: GACTCATGGGAGTGAGGAC
Primer 2ct119523.reverse primer: TGAACTTGTGTAGTCTTTACCG
Max Length279
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG4N/A3.08ct119523View
2Cranberry-Crimson_Queen-2007LG4N/A1.2ct119523View
3Cranberry-CNJ02-1-2017LG04N/A2.4ct119523View
4Cranberry-Crimson_Queen-F1LG04N/A0ct119523View
5Cranberry-Mullica_Queen-2017LG04N/A2.7ct119523View
6Cranberry-Mullica_Queen-2007LG4N/A3.6ct119523View
7Cranberry-Composite_map-F1LG04N/A1.19ct119523View
8Cranberry-Mullica_Queen_1-F1LG04N/A4.76ct119523View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279114
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerct119523.forward primerVaccinium macrocarponprimer
reverse primerct119523.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ct119523ct119523Vaccinium macrocarponmarker_locus
ct119523ct119523-1.19Vaccinium macrocarponmarker_locus
ct119523ct119523-4.76Vaccinium macrocarponmarker_locus