418596_K63, 418596_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name418596_K63
Genbank IDKP279190
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)17
Primer 1418596_K63.forward primer: CGTGAGTTTGAGTGAGTAATTG
Primer 2418596_K63.reverse primer: AGGACATGGTGAGTTGAGAAT
Max Length401
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG12N/A19.8418596_K63View
2Cranberry-CNJ02-1-2007LG12N/A31.09418596_K63View
3Cranberry-Crimson_Queen-2007LG12N/A27418596_K63View
4Cranberry-Mullica_Queen-2017LG12N/A35.8418596_K63View
5Cranberry-CNJ02-1-2017LG12N/A28418596_K63View
6Cranberry-Mullica_Queen-2007LG12N/A38.6418596_K63View
7Cranberry-Composite_map-F1LG12N/A62.39418596_K63View
8Cranberry-Crimson_Queen-F1LG12N/A42.42418596_K63View
9Cranberry-Mullica_Queen_1-F1LG12N/A65.03418596_K63View
10Cranberry-Mullica_Queen_2-F1LG12N/A51.29418596_K63View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279190
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer418596_K63.forward primerVaccinium macrocarponprimer
reverse primer418596_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
418596_K63418596_K63Vaccinium macrocarponmarker_locus
418596_K63418596_K63-62.39Vaccinium macrocarponmarker_locus
418596_K63418596_K63-42.42Vaccinium macrocarponmarker_locus
418596_K63418596_K63-65.03Vaccinium macrocarponmarker_locus
418596_K63418596_K63-51.29Vaccinium macrocarponmarker_locus