Contig259Fb, Contig259Fb (genetic_marker) Vaccinium corymbosum

Marker Overview
NameContig259Fb
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Primer 1Contig259Fb.forward primer: TTGCTGAAGCCCTAAGCAGT
Primer 2Contig259Fb.reverse primer: AAACCAGATCTGTTGGACGC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG09N/A0Contig259FbView
2Cranberry-Mullica_Queen-2017LG09N/A0Contig259FbView
3Cranberry-Crimson_Queen-2017LG09N/A0Contig259FbView
4Cranberry-Mullica_Queen-2007LG9N/A0Contig259FbView
5Cranberry-Crimson_Queen-2007LG9N/A0Contig259FbView
6Cranberry-CNJ02-1-2007LG9N/A0Contig259FbView
7Cranberry-Composite_map-F1LG09N/A89.86contig259FbView
8Cranberry-Mullica_Queen_1-F1LG09N/A107.9contig259FbView
9Cranberry-BB/CQ-F1LG01N/A102.87Contig259FbView
10Cranberry-BB/CQ-F1LG01N/A96.11Contig259FbView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerContig259Fb.forward primerVaccinium corymbosumprimer
reverse primerContig259Fb.reverse primerVaccinium corymbosumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Proanthocyanidin contentqPAC.CNJ02-1.LG09Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Contig259FbContig259FbVaccinium corymbosummarker_locus
contig259Fbcontig259Fb-89.86Vaccinium corymbosummarker_locus
contig259Fbcontig259Fb-107.9Vaccinium corymbosummarker_locus
Contig259FbContig259Fb-102.868Vaccinium corymbosummarker_locus
Contig259FbContig259Fb-96.111Vaccinium corymbosummarker_locus