419834_K63, 419834_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name419834_K63
Genbank IDKP279192
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)16
Primer 1419834_K63.forward primer: GAAAAGAGAGGAGAAGATGGAT
Primer 2419834_K63.reverse primer: TACCAGAACTGTGTGAGATTGT
Max Length208
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG7N/A19.5419834_K63View
2Cranberry-CNJ02-1-2007LG7N/A18.28419834_K63View
3Cranberry-Mullica_Queen-2017LG07N/A23.9419834_K63View
4Cranberry-Crimson_Queen-2007LG7N/A17419834_K63View
5Cranberry-CNJ02-1-2017LG07N/A18.5419834_K63View
6Cranberry-Crimson_Queen-2017LG07N/A13.8419834_K63View
7Cranberry-Composite_map-F1LG07N/A77.73419834_K63View
8Cranberry-Crimson_Queen-F1LG07N/A73.88419834_K63View
9Cranberry-Mullica_Queen_1-F1LG07N/A88.49419834_K63View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279192
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer419834_K63.forward primerVaccinium macrocarponprimer
reverse primer419834_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
419834_K63419834_K63Vaccinium macrocarponmarker_locus
419834_K63419834_K63-77.73Vaccinium macrocarponmarker_locus
419834_K63419834_K63-73.88Vaccinium macrocarponmarker_locus
419834_K63419834_K63-88.49Vaccinium macrocarponmarker_locus