482_K70, 482_K70 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name482_K70
Genbank IDKP279193
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)15
Primer 1482_K70.forward primer: ACAGCGGCATAGTAAAATGA
Primer 2482_K70.reverse primer: GTCACCGAAATCTCACTCAATA
Max Length192
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG11N/A46.9482_K70View
2Cranberry-Mullica_Queen-2017LG11N/A55.5482_K70View
3Cranberry-Mullica_Queen-2007LG11N/A62.4482_K70View
4Cranberry-CNJ02-1-2017LG11N/A51.7482_K70View
5Cranberry-Crimson_Queen-2007LG11N/A48.6482_K70View
6Cranberry-CNJ02-1-2007LG11N/A53.15482_K70View
7Cranberry-Composite_map-F1LG11N/A53.59482_K70View
8Cranberry-Crimson_Queen-F1LG11N/A47.83482_K70View
9Cranberry-Mullica_Queen_1-F1LG11N/A61.57482_K70View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279193
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer482_K70.forward primerVaccinium macrocarponprimer
reverse primer482_K70.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
482_K70482_K70Vaccinium macrocarponmarker_locus
482_K70482_K70-53.59Vaccinium macrocarponmarker_locus
482_K70482_K70-47.83Vaccinium macrocarponmarker_locus
482_K70482_K70-61.57Vaccinium macrocarponmarker_locus