49132_K63, 49132_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name49132_K63
Genbank IDKP279256
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)18
Primer 149132_K63.forward primer: AACCCTAGAAATCAATGCAC
Primer 249132_K63.reverse primer: GTTTTCCGTTTTGTTCTGTC
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279256
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer49132_K63.forward primerVaccinium macrocarponprimer
reverse primer49132_K63.reverse primerVaccinium macrocarponprimer