5ms2b12, 5ms2b12 (genetic_marker) Vaccinium corymbosum

Marker Overview
Genbank IDN/A
SpeciesVaccinium corymbosum
Primer 15ms2b12.forward primer: AAAACTGCAACTGGAATCGG
Primer 25ms2b12.reverse primer: GTCTGCAGGTCACAGGTTCA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer5ms2b12.forward primerVaccinium corymbosumprimer
reverse primer5ms2b12.reverse primerVaccinium corymbosumprimer

This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Fruit color intensityqFCI.CNJ02-1.LG04Vaccinium macrocarponQTL
Fruit color variationqFCV.CNJ02-1.LG04Vaccinium macrocarponQTL

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
5ms2b125ms2b12Vaccinium corymbosummarker_locus
5ms2b125ms2b12-18.45Vaccinium corymbosummarker_locus
5ms2b125ms2b12-19.71Vaccinium corymbosummarker_locus
5ms2b125ms2b12-20.97Vaccinium corymbosummarker_locus
5ms2b125ms2b12-11.96Vaccinium corymbosummarker_locus
5ms2b125ms2b12-13.685Vaccinium corymbosummarker_locus