ct155461, ct155461 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect155461
Genbank IDKP279141
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TG)10
Primer 1ct155461.forward primer: GGTTTCAAACTCGAACAAAG
Primer 2ct155461.reverse primer: ATCCTATAACTGGGGATAATGC
Max Length277
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2017LG02N/A57.7ct155461ViewN/A
2Cranberry-Mullica_Queen-2007LG2N/A65.9ct155461ViewN/A
3Cranberry-Mullica_Queen-2017LG02N/A61.5ct155461ViewN/A
4Cranberry-CNJ02-1-2007LG2N/A59.21ct155461ViewN/A
5Cranberry-Composite_map-F1LG02N/A43.42ct155461ViewN/A
6Cranberry-GH1/35-F1LG02N/A39.18ct155461ViewN/A
7Cranberry-Mullica_Queen_1-F1LG02N/A53.83ct155461ViewN/A
8Cranberry-BB/CQ-F1LG08N/A36.49ct155461ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279141
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerct155461.forward primerVaccinium macrocarponprimer
reverse primerct155461.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ct155461ct155461Vaccinium macrocarponmarker_locus
ct155461ct155461-43.42Vaccinium macrocarponmarker_locus
ct155461ct155461-39.18Vaccinium macrocarponmarker_locus
ct155461ct155461-53.83Vaccinium macrocarponmarker_locus
ct155461ct155461-36.489Vaccinium macrocarponmarker_locus