NA172, NA172 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameNA172
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Primer 1NA172.forward primer: CCTCGTCCTCCTCTTCCTCT
Primer 2NA172.reverse primer: GTTTGACTTTGGAGAAGGCGAAG
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG3N/A2.88NA172View
2Blueberry-F1#10_x_W85-23-F1-2017LG03N/A2.9NA172View
3Cranberry-Mullica_Queen-2017LG03N/A10.2NA172View
4Cranberry-Unifiedmap2013LG7aN/A0NA172View
5Cranberry-BB/CQ-F1LG07N/A0NA172View
6Cranberry-Crimson_Queen-2017LG03N/A0NA172View
7Blueberry-W85-23-2017LG03N/A1.2NA172View
8Cranberry-Crimson_Queen-2007LG3N/A1.5NA172View
9Cranberry-Mullica_Queen-2007LG3N/A5.3NA172View
10Cranberry-CNJ02-1-2017LG03N/A4.8NA172View
11Cranberry-Composite_map-F1LG03N/A87.55NA172View
12Cranberry-Crimson_Queen-F1LG03N/A86.65NA172View
13Cranberry-GH1/35-F1LG03N/A86.39NA172View
14Cranberry-Mullica_Queen_1-F1LG03N/A108.21NA172View
15Cranberry-BB/CQ-F1LG07N/A2.27NA172View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerNA172.forward primerVaccinium corymbosumprimer
reverse primerNA172.reverse primerVaccinium corymbosumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NA172NA172Vaccinium corymbosummarker_locus
NA172NA172-87.55Vaccinium corymbosummarker_locus
NA172NA172-86.65Vaccinium corymbosummarker_locus
NA172NA172-86.39Vaccinium corymbosummarker_locus
NA172NA172-108.21Vaccinium corymbosummarker_locus
NA172NA172-2.274Vaccinium corymbosummarker_locus