SCAR910, SCAR910 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCAR910
Genbank ID	N/A
Type	SCAR
Species	Vaccinium macrocarpon
Primer 1	SCAR910.forward primer: GTTTCGCTCCCGTGGAGGTACT
Primer 2	SCAR910.reverse primer: GTTTCGCTCCTCTTATCAATGT
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
chr2	supercontig	chr2:1381397..1381779 .	Vaccinium macrocarpon cv. Stevens v1.0 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2002	Polashock J, Vorsa N. Development of SCAR markers for DNA fingerprinting and germplasm analysis of American cranberry. Journal of the American Society for Horticultural Science. 2002 July; 127(4):677-684.