SCAR4849, SCAR4849 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCAR4849
Genbank ID	N/A
Type	SCAR
Species	Vaccinium macrocarpon
Primer 1	SCAR4849.forward primer: TTGCGTCATGTATTGTGAAAAAAA
Primer 2	SCAR4849.reverse primer: TTGCGTCATGATGAGATTTGAATA
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Vmac_chr01	supercontig	Vmac_chr01:38882129..38883057 .	Vaccinium macrocarpon cv. Ben Lear v1.0 genome sequence	GDV marker alignment to genome using primer sequences
chr1	supercontig	chr1:11435728..11436658 .	Vaccinium macrocarpon cv. Stevens v1.0 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2002	Polashock J, Vorsa N. Development of SCAR markers for DNA fingerprinting and germplasm analysis of American cranberry. Journal of the American Society for Horticultural Science. 2002 July; 127(4):677-684.