SCF101914, SCF101914 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF101914
Genbank IDKP278806
TypeSSR
SpeciesVaccinium macrocarpon
Repeat MotifTC)10
Primer 1SCF101914.forward primer: CTTTGGAGCACAACAACTCTA
Primer 2SCF101914.reverse primer: GTGTAAAGACCAGGACCCTT
Max Length165
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG12N/A5.8SCF101914View
2Cranberry-Crimson_Queen-2007LG12N/A8.4SCF101914View
3Cranberry-CNJ02-1-2007LG12N/A8.16SCF101914View
4Cranberry-Crimson_Queen-2017LG12N/A0.9SCF101914View
5Cranberry-Composite_map-F1LG12N/A85.12SCF101914View
6Cranberry-Crimson_Queen-F1LG12N/A59.72SCF101914View
7Cranberry-Stevens-F1LG12N/A69.18SCF101914View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278806
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF101914.forward primerVaccinium macrocarponprimer
reverse primerSCF101914.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF101914SCF101914Vaccinium macrocarponmarker_locus
SCF101914SCF101914-85.12Vaccinium macrocarponmarker_locus
SCF101914SCF101914-59.72Vaccinium macrocarponmarker_locus
SCF101914SCF101914-69.18Vaccinium macrocarponmarker_locus