scf108b, scf108b (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf108b
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf108b.forward primer: ACATAAACGGCGATTCCAAC
Primer 2	scf108b.reverse primer: ATTGCTCGAGGATTGGACAC
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr11	supercontig	Vmac_chr11:2906376..2906849 .
chr1	supercontig	chr1:3988100..3988585 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG11	N/A	3.11	scf108b	View
2	Cranberry-Crimson_Queen-2007	LG11	N/A	0	scf108b	View
3	Cranberry-Mullica_Queen-2007	LG11	N/A	3.9	scf108b	View
4	Cranberry-Unifiedmap2013	LG11b	N/A	52.2	scf108b	View
5	Cranberry-Crimson_Queen-F1	LG11	N/A	0	scf108b	View
6	Cranberry-CNJ02-1-2017	LG11	N/A	5	scf108b	View
7	Cranberry-Crimson_Queen-2017	LG11	N/A	0	scf108b	View
8	Cranberry-Mullica_Queen-2017	LG11	N/A	7.3	scf108b	View
9	Cranberry-Composite_map-F1	LG11	N/A	2.38	scf108b	View
10	Cranberry-Mullica_Queen_1-F1	LG11	N/A	2.38	scf108b	View
11	Cranberry-BB/CQ-F1	LG11	N/A	96.42	scf108b	View
12	Cranberry-BB/CQ-F1	LG11	N/A	2.28	scf108b	View