SCF109660, SCF109660 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF109660
Genbank IDKP278821
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)9
Primer 1SCF109660.forward primer: CCCCAAACTGTCGTATAAAA
Primer 2SCF109660.reverse primer: TAGAGTACAGGAAAAGCCCTAA
Max Length291
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG09N/A87.09SCF109660View
2Cranberry-CNJ02-1-2017LG09N/A2.7SCF109660View
3Cranberry-Mullica_Queen_1-F1LG09N/A100.16SCF109660View
4Cranberry-Mullica_Queen-2017LG09N/A2.3SCF109660View
5Cranberry-Mullica_Queen-2007LG9N/A8SCF109660View
6Cranberry-CNJ02-1-2007LG9N/A9.17SCF109660View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278821
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF109660.forward primerVaccinium macrocarponprimer
reverse primerSCF109660.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF109660SCF109660Vaccinium macrocarponmarker_locus
SCF109660SCF109660-87.09Vaccinium macrocarponmarker_locus
SCF109660SCF109660-100.16Vaccinium macrocarponmarker_locus