scf112c, scf112c (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf112c
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf112c.forward primer: ATGTGATTCGCGAAGGATTC
Primer 2scf112c.reverse primer: GAAATCCGGGGGTGTAAACT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG6N/A68.2scf112cView
2Cranberry-Crimson_Queen-2017LG06N/A44.1scf112cView
3Cranberry-CNJ02-1-2007LG6N/A53.02scf112cView
4Blueberry-F1#10-2017LG06N/A53scf112cView
5Cranberry-CNJ02-1-2017LG06N/A48scf112cView
6Cranberry-Mullica_Queen-2017LG06N/A52.4scf112cView
7Cranberry-Crimson_Queen-2007LG6N/A48.5scf112cView
8Blueberry-W85-23-2017LG06N/A39.4scf112cView
9Blueberry-F1#10_x_W85-23-F1-2017LG06N/A45scf112cView
10Cranberry-Unifiedmap2013LG5N/A61.7scf112cView
11Cranberry-Mullica_Queen-2007LG6N/A62.9scf112cView
12Cranberry-[BG//BL/BN]95-F1LG06N/A57.79scf112cView
13Cranberry-Composite_map-F1LG06N/A45.88scf112cView
14Cranberry-Crimson_Queen-F1LG06N/A38.14scf112cView
15Cranberry-Mullica_Queen_1-F1LG06N/A51.94scf112cView
16Cranberry-Mullica_Queen_2-F1LG06N/A58.32scf112cView
17Cranberry-Stevens-F1LG06N/A47.85scf112cView
18Cranberry-BB/CQ-F1LG05N/A39.04scf112cView
19Cranberry-BB/CQ-F1LG05N/A48.78scf112cView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf112c.forward primerVaccinium macrocarponprimer
reverse primerscf112c.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf112cscf112cVaccinium macrocarponmarker_locus
scf112cscf112c-57.79Vaccinium macrocarponmarker_locus
scf112cscf112c-45.88Vaccinium macrocarponmarker_locus
scf112cscf112c-38.14Vaccinium macrocarponmarker_locus
scf112cscf112c-51.94Vaccinium macrocarponmarker_locus
scf112cscf112c-58.32Vaccinium macrocarponmarker_locus
scf112cscf112c-47.85Vaccinium macrocarponmarker_locus
scf112cscf112c-39.038Vaccinium macrocarponmarker_locus
scf112cscf112c-48.779Vaccinium macrocarponmarker_locus