SCF107477, SCF107477 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF107477
Genbank IDKP278814
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)10
Primer 1SCF107477.forward primer: GTCTTATTTTCACTGTCGTGTG
Primer 2SCF107477.reverse primer: CGGGCATTAACCTTATACCT
Max Length200
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG8N/A80.4SCF107477View
2Cranberry-CNJ02-1-2017LG08N/A70SCF107477View
3Cranberry-Crimson_Queen-2007LG8N/A68.6SCF107477View
4Cranberry-Mullica_Queen-2017LG08N/A72.2SCF107477View
5Cranberry-CNJ02-1-2007LG8N/A75.44SCF107477View
6Cranberry-Crimson_Queen-2017LG08N/A64.3SCF107477View
7Cranberry-Composite_map-F1LG08N/A14.65SCF107477View
8Cranberry-Crimson_Queen-F1LG08N/A6.55SCF107477View
9Cranberry-Mullica_Queen_1-F1LG08N/A24.68SCF107477View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278814
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF107477.forward primerVaccinium macrocarponprimer
reverse primerSCF107477.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Brix (soluble solids)qSS.CNJ02-1.LG08Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF107477SCF107477Vaccinium macrocarponmarker_locus
SCF107477SCF107477-14.65Vaccinium macrocarponmarker_locus
SCF107477SCF107477-6.55Vaccinium macrocarponmarker_locus
SCF107477SCF107477-24.68Vaccinium macrocarponmarker_locus