SCF118536, SCF118536 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF118536
Genbank ID	KP279062
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(GA)10
Primer 1	SCF118536.forward primer: GGGTACTATATGAAGGTGCCTA
Primer 2	SCF118536.reverse primer: CTACCATGTAACCCTTGAAAGT
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279062

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Vmac_chr07	supercontig	Vmac_chr07:34644419..34644678 .	Vaccinium macrocarpon cv. Ben Lear v1.0 genome sequence	GDV marker alignment to genome using primer sequences
chr7	supercontig	chr7:33667386..33667633 .	Vaccinium macrocarpon cv. Stevens v1.0 genome sequence	GDV marker alignment to genome using primer sequences

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.