SCF132006, SCF132006 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF132006
Genbank ID	KP279075
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(GT)9
Primer 1	SCF132006.forward primer: ATTGAGGTCACTAGGAGGTGTA
Primer 2	SCF132006.reverse primer: GAGGAGAGTGTTTATGTTCATGT
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279075

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10_x_W85-23-F1-2017	LG06	N/A	42.9	SCF132006	View
2	Blueberry-F1#10-2017	LG06	N/A	49.3	SCF132006	View
3	Blueberry-W85-23-2017	LG06	N/A	39.4	SCF132006	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr06	supercontig	Vmac_chr06:27114638..27114882 .
chr6	supercontig	chr6:12206798..12207045 .