SCF141985, SCF141985 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF141985
Genbank IDKP278878
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)11
Primer 1SCF141985.forward primer: GAATGGTCTTGAGGGATGTAT
Primer 2SCF141985.reverse primer: ACTCTGGAAGAAATAAAACGG
Max Length188
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2017LG09N/A77.6SCF141985View
2Cranberry-CNJ02-1-2017LG09N/A64.8SCF141985View
3Cranberry-CNJ02-1-2007LG9N/A74.05SCF141985View
4Cranberry-Crimson_Queen-2017LG09N/A54.2SCF141985View
5Cranberry-Mullica_Queen-2007LG9N/A89.4SCF141985View
6Cranberry-Crimson_Queen-2007LG9N/A66.7SCF141985View
7Cranberry-Composite_map-F1LG09N/A21.73SCF141985View
8Cranberry-Crimson_Queen-F1LG09N/A16.16SCF141985View
9Cranberry-Mullica_Queen_1-F1LG09N/A24.49SCF141985View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278878
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF141985.forward primerVaccinium macrocarponprimer
reverse primerSCF141985.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF141985SCF141985Vaccinium macrocarponmarker_locus
SCF141985SCF141985-21.73Vaccinium macrocarponmarker_locus
SCF141985SCF141985-16.16Vaccinium macrocarponmarker_locus
SCF141985SCF141985-24.49Vaccinium macrocarponmarker_locus