SCF142441, SCF142441 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF142441
Genbank IDKP278879
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)10
Primer 1SCF142441.forward primer: TTGCGTTTACTATCTAAGGAGG
Primer 2SCF142441.reverse primer: CTCAGCCGTCCAAAAGTAT
Max Length233
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2007LG1N/A69.76SCF142441ViewN/A
2Cranberry-Crimson_Queen-2017LG01N/A56.4SCF142441ViewN/A
3Cranberry-Mullica_Queen-2017LG01N/A77.5SCF142441ViewN/A
4Cranberry-Crimson_Queen-2007LG1N/A59.4SCF142441ViewN/A
5Cranberry-CNJ02-1-2017LG01N/A66.2SCF142441ViewN/A
6Cranberry-Mullica_Queen-2007LG1N/A80.4SCF142441ViewN/A
7Cranberry-Composite_map-F1LG01N/A40.43SCF142441ViewN/A
8Cranberry-Crimson_Queen-F1LG01N/A21.44SCF142441ViewN/A
9Cranberry-Mullica_Queen_1-F1LG01N/A22.65SCF142441ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278879
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF142441.forward primerVaccinium macrocarponprimer
reverse primerSCF142441.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF142441SCF142441Vaccinium macrocarponmarker_locus
SCF142441SCF142441-40.43Vaccinium macrocarponmarker_locus
SCF142441SCF142441-21.44Vaccinium macrocarponmarker_locus
SCF142441SCF142441-22.65Vaccinium macrocarponmarker_locus