SCF147295, SCF147295 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF147295
Genbank ID	KP278889
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(GA)9
Primer 1	SCF147295.forward primer: ACTGAGGTAAAAGAGGAGTACG
Primer 2	SCF147295.reverse primer: CCATCAAGGTCTCAATCTGT
Max Length	207
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278889

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr10	supercontig	Vmac_chr10:15528448..15528620 .
chr10	supercontig	chr10:15246030..15246202 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG10	N/A	48.52	SCF147295	View
2	Cranberry-Mullica_Queen-2007	LG10	N/A	58	SCF147295	View
3	Blueberry-F1#10_x_W85-23-F1-2017	LG10	N/A	31.2	SCF147295	View
4	Blueberry-F1#10-2017	LG10	N/A	39.4	SCF147295	View
5	Cranberry-CNJ02-1-2017	LG10	N/A	40	SCF147295	View
6	Cranberry-Mullica_Queen-2017	LG10	N/A	47.6	SCF147295	View
7	Cranberry-Composite_map-F1	LG10	N/A	39.03	SCF147295	View
8	Cranberry-Mullica_Queen_1-F1	LG10	N/A	38.19	SCF147295	View
9	Cranberry-Mullica_Queen_2-F1	LG10	N/A	35.93	SCF147295	View