SCF149976, SCF149976 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF149976
Genbank IDKP278893
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TTC)19
Primer 1SCF149976.forward primer: TATACCCATGTATGTACGCATC
Primer 2SCF149976.reverse primer: ACTCTAAGCAGGACAATGCTAT
Max Length309
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG5N/A44SCF149976View
2Cranberry-Crimson_Queen-2017LG05N/A40.4SCF149976View
3Cranberry-Mullica_Queen-2007LG5N/A61SCF149976View
4Cranberry-Mullica_Queen-2017LG05N/A50.4SCF149976View
5Cranberry-CNJ02-1-2017LG05N/A44.6SCF149976View
6Cranberry-CNJ02-1-2007LG5N/A51.26SCF149976View
7Cranberry-Composite_map-F1LG05N/A47.12SCF149976View
8Cranberry-Crimson_Queen-F1LG05N/A41.01SCF149976View
9Cranberry-Mullica_Queen_1-F1LG05N/A54.9SCF149976View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278893
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF149976.forward primerVaccinium macrocarponprimer
reverse primerSCF149976.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF149976SCF149976Vaccinium macrocarponmarker_locus
SCF149976SCF149976-47.12Vaccinium macrocarponmarker_locus
SCF149976SCF149976-41.01Vaccinium macrocarponmarker_locus
SCF149976SCF149976-54.9Vaccinium macrocarponmarker_locus