SCF177450, SCF177450 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF177450
Genbank IDKP278928
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)10
Primer 1SCF177450.forward primer: TCTAAAACTCTCCTCTCACCTC
Primer 2SCF177450.reverse primer: GATAGCAGTGGACTCATGTCT
Max Length271
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG3N/A27.92SCF177450View
2Cranberry-CNJ02-1-2017LG03N/A22.9SCF177450View
3Cranberry-Crimson_Queen-2017LG03N/A20.3SCF177450View
4Cranberry-Crimson_Queen-2007LG3N/A24.2SCF177450View
5Cranberry-Composite_map-F1LG03N/A62.75SCF177450View
6Cranberry-Crimson_Queen-F1LG03N/A61.6SCF177450View
7Cranberry-Stevens-F1LG03N/A46.41SCF177450View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278928
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF177450.forward primerVaccinium macrocarponprimer
reverse primerSCF177450.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF177450SCF177450Vaccinium macrocarponmarker_locus
SCF177450SCF177450-62.75Vaccinium macrocarponmarker_locus
SCF177450SCF177450-61.6Vaccinium macrocarponmarker_locus
SCF177450SCF177450-46.41Vaccinium macrocarponmarker_locus