scf2000b, scf2000b (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf2000b
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf2000b.forward primer: GGCCCTTTTTATCCCCAATA
Primer 2scf2000b.reverse primer: AATCAAAAGCTGCGAGGAAA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Unifiedmap2013LG8N/A27.4scf2000bViewN/A
2Cranberry-Crimson_Queen-2017LG02N/A44.3scf2000bViewN/A
3Blueberry-F1#10-2017LG02N/A13.3scf2000bViewN/A
4Cranberry-BB/CQ-F1LG08N/A48.4scf2000bViewN/A
5Cranberry-CNJ02-1-2007LG2N/A53.41scf2000bViewN/A
6Cranberry-Crimson_Queen-2007LG2N/A49scf2000bViewN/A
7Cranberry-Mullica_Queen-2017LG02N/A52.6scf2000bViewN/A
8Cranberry-CNJ02-1-2017LG02N/A49.4scf2000bViewN/A
9Blueberry-F1#10_x_W85-23-F1-2017LG02N/A48.7scf2000bViewN/A
10Blueberry-W85-23-2017LG02N/A47.5scf2000bViewN/A
11Cranberry-Mullica_Queen-2007LG2N/A59.4scf2000bViewN/A
12Cranberry-Composite_map-F1LG02N/A50.21scf2000bViewN/A
13Cranberry-Crimson_Queen-F1LG02N/A52.49scf2000bViewN/A
14Cranberry-Mullica_Queen_1-F1LG02N/A62.31scf2000bViewN/A
15Cranberry-Mullica_Queen_2-F1LG02N/A61.51scf2000bViewN/A
16Cranberry-Stevens-F1LG02N/A40.39scf2000bViewN/A
17Cranberry-BB/CQ-F1LG08N/A65.97scf2000bViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf2000b.forward primerVaccinium macrocarponprimer
reverse primerscf2000b.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf2000bscf2000bVaccinium macrocarponmarker_locus
scf2000bscf2000b-50.21Vaccinium macrocarponmarker_locus
scf2000bscf2000b-52.49Vaccinium macrocarponmarker_locus
scf2000bscf2000b-62.31Vaccinium macrocarponmarker_locus
scf2000bscf2000b-61.51Vaccinium macrocarponmarker_locus
scf2000bscf2000b-40.39Vaccinium macrocarponmarker_locus
scf2000bscf2000b-48.4Vaccinium macrocarponmarker_locus
scf2000bscf2000b-65.967Vaccinium macrocarponmarker_locus