SCF204332, SCF204332 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF204332
Genbank IDKP278948
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)9
Primer 1SCF204332.forward primer: CGTGATCTCCCAGAGTTGT
Primer 2SCF204332.reverse primer: CTTTTATTTCCCTATGTGTCCC
Max Length182
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Mullica_Queen-2007LG11N/A28.3SCF204332ViewN/A
2Cranberry-CNJ02-1-2017LG11N/A25.7SCF204332ViewN/A
3Cranberry-CNJ02-1-2007LG11N/A24.18SCF204332ViewN/A
4Cranberry-Mullica_Queen-2017LG11N/A28.6SCF204332ViewN/A
5Cranberry-Composite_map-F1LG11N/A23.86SCF204332ViewN/A
6Cranberry-GH1/35-F1LG11N/A19.88SCF204332ViewN/A
7Cranberry-Mullica_Queen_1-F1LG11N/A34.76SCF204332ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278948
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF204332.forward primerVaccinium macrocarponprimer
reverse primerSCF204332.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
total fruit yieldqFYLD.CNJ02-01.LG11Vaccinium macrocarponQTL
total fruit yieldqFYLD.CNJ02-01.LG11.2012Vaccinium macrocarponQTL
biennial bearing indexqBBI.CNJ02-1.LG11Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF204332SCF204332Vaccinium macrocarponmarker_locus
SCF204332SCF204332-23.86Vaccinium macrocarponmarker_locus
SCF204332SCF204332-19.88Vaccinium macrocarponmarker_locus
SCF204332SCF204332-34.76Vaccinium macrocarponmarker_locus