SCF208509, SCF208509 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF208509
Genbank IDKP278950
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)14
Primer 1SCF208509.forward primer: GCTTCACACTTGATAGTAGGTTG
Primer 2SCF208509.reverse primer: TACCGCCATTGTAGCAGAT
Max Length165
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2007LG1N/A3.3SCF208509ViewN/A
2Cranberry-CNJ02-1-2017LG01N/A2.6SCF208509ViewN/A
3Cranberry-Crimson_Queen-2017LG01N/A0SCF208509ViewN/A
4Cranberry-Crimson_Queen-2007LG1N/A0.3SCF208509ViewN/A
5Cranberry-Composite_map-F1LG01N/A111.98SCF208509ViewN/A
6Cranberry-Crimson_Queen-F1LG01N/A79.29SCF208509ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278950
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF208509.forward primerVaccinium macrocarponprimer
reverse primerSCF208509.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF208509SCF208509Vaccinium macrocarponmarker_locus
SCF208509SCF208509-111.98Vaccinium macrocarponmarker_locus
SCF208509SCF208509-79.29Vaccinium macrocarponmarker_locus