scf2177, scf2177 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf2177
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf2177.forward primer: TCCGGCAACCTACAATCTTC
Primer 2	scf2177.reverse primer: AACCACCGGAACCCATTATT
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr06	supercontig	Vmac_chr06:38025812..38026236 .
chr6	supercontig	chr6:1651152..1651588 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG2	N/A	30.7	scf2177	View