scf222a, scf222a (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf222a
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf222a.forward primer: CATGGAAAGGGCAAGTGATT
Primer 2	scf222a.reverse primer: GAGTCTGAATTCCAGCAGCC
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr04	supercontig	Vmac_chr04:33813369..33813555 .
scaffold00555	supercontig	scaffold00555:28736..28912 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG2	N/A	108.1	scf222a	View
2	Cranberry-BB/CQ-F1	LG02	N/A	92.77	scf222a	View