scf2253d, scf2253d (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf2253d
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf2253d.forward primer: TGGATTGTAACCAAGGGCTC
Primer 2scf2253d.reverse primer: GCCCATCAACACGTAAACCTT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Unifiedmap2013LG7aN/A67.7scf2253dView
2Cranberry-BB/CQ-F1LG07N/A52.2scf2253dView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf2253d.forward primerVaccinium macrocarponprimer
reverse primerscf2253d.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf2253dscf2253dVaccinium macrocarponmarker_locus
scf2253dscf2253d-52.201Vaccinium macrocarponmarker_locus