SCF180863, SCF180863 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF180863
Genbank IDKP278930
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)11
Primer 1SCF180863.forward primer: CCAGTTACAGATCCTTGAGTTG
Primer 2SCF180863.reverse primer: GCAATGTTCCCTCGAATTA
Max Length181
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG2N/A118.8SCF180863View
2Cranberry-Crimson_Queen-F1LG02N/A0SCF180863View
3Cranberry-Mullica_Queen-2017LG02N/A107.3SCF180863View
4Cranberry-Crimson_Queen-2017LG02N/A92.3SCF180863View
5Cranberry-Crimson_Queen-2007LG2N/A95.9SCF180863View
6Cranberry-CNJ02-1-2017LG02N/A99.9SCF180863View
7Cranberry-CNJ02-1-2007LG2N/A107.83SCF180863View
8Cranberry-Mullica_Queen_1-F1LG02N/A0SCF180863View
9Cranberry-Composite_map-F1LG02N/A0SCF180863View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278930
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF180863.forward primerVaccinium macrocarponprimer
reverse primerSCF180863.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF180863SCF180863Vaccinium macrocarponmarker_locus
SCF180863SCF180863-1.11E-16Vaccinium macrocarponmarker_locus