scf258d, scf258d (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf258d
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf258d.forward primer: GTAACGCATTGGTCGGCTAT
Primer 2	scf258d.reverse primer: TAAGCCAAACCCAATCCAAC
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr01	supercontig	Vmac_chr01:49099270..49099477 .
chr1	supercontig	chr1:897956..898169 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG9	N/A	36.4	scf258d	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG01	N/A	20.4	scf258d	View
3	Blueberry-F1#10-2017	LG01	N/A	27.9	scf258d	View
4	Blueberry-W85-23-2017	LG01	N/A	9.8	scf258d	View