SCF22962, SCF22962 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF22962
Genbank IDKP278659
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AC)9
Primer 1SCF22962.forward primer: GTGCAACAGCTAACAGCATA
Primer 2SCF22962.reverse primer: AGGACCAATACTCAGAACAAAC
Max Length204
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Mullica_Queen-2007LG1N/A89.2SCF22962ViewN/A
2Cranberry-CNJ02-1-2017LG01N/A74.8SCF22962ViewN/A
3Cranberry-Mullica_Queen-2017LG01N/A85.3SCF22962ViewN/A
4Cranberry-CNJ02-1-2007LG1N/A78.07SCF22962ViewN/A
5Cranberry-Composite_map-F1LG01N/A31.68SCF22962ViewN/A
6Cranberry-Mullica_Queen_1-F1LG01N/A13.71SCF22962ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278659
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF22962.forward primerVaccinium macrocarponprimer
reverse primerSCF22962.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF22962SCF22962Vaccinium macrocarponmarker_locus
SCF22962SCF22962-31.68Vaccinium macrocarponmarker_locus
SCF22962SCF22962-13.71Vaccinium macrocarponmarker_locus