SCF23691, SCF23691 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF23691
Genbank IDKP278662
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TCT)13
Primer 1SCF23691.forward primer: CGGCTTTGTTAGTTGATGTT
Primer 2SCF23691.reverse primer: CGATGTTGTACTATTCATGTCC
Max Length281
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Crimson_Queen-2007LG1N/A5.2SCF23691ViewN/A
2Cranberry-Mullica_Queen-2007LG1N/A10.8SCF23691ViewN/A
3Cranberry-Crimson_Queen-2017LG01N/A4.6SCF23691ViewN/A
4Cranberry-CNJ02-1-2007LG1N/A8.91SCF23691ViewN/A
5Cranberry-CNJ02-1-2017LG01N/A8.4SCF23691ViewN/A
6Cranberry-Mullica_Queen-2017LG01N/A10.1SCF23691ViewN/A
7Cranberry-Composite_map-F1LG01N/A106.91SCF23691ViewN/A
8Cranberry-Crimson_Queen-F1LG01N/A74.53SCF23691ViewN/A
9Cranberry-GH1/35-F1LG01N/A105.48SCF23691ViewN/A
10Cranberry-Mullica_Queen_1-F1LG01N/A95.04SCF23691ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278662
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF23691.forward primerVaccinium macrocarponprimer
reverse primerSCF23691.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF23691SCF23691Vaccinium macrocarponmarker_locus
SCF23691SCF23691-106.91Vaccinium macrocarponmarker_locus
SCF23691SCF23691-74.53Vaccinium macrocarponmarker_locus
SCF23691SCF23691-105.48Vaccinium macrocarponmarker_locus
SCF23691SCF23691-95.04Vaccinium macrocarponmarker_locus