SCF2714, SCF2714 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF2714
Genbank IDKP278602
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)9
Primer 1SCF2714.forward primer: ACAAGTCTCTGGAAGCTAACAT
Primer 2SCF2714.reverse primer: GTTGATTGTTGGGTCTAAGTTC
Max Length208
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG08N/A27SCF2714View
2Cranberry-CNJ02-1-2007LG8N/A25.35SCF2714View
3Cranberry-Crimson_Queen-2017LG08N/A22.6SCF2714View
4Cranberry-Crimson_Queen-2007LG8N/A22.4SCF2714View
5Cranberry-Composite_map-F1LG08N/A60.93SCF2714View
6Cranberry-Crimson_Queen-F1LG08N/A50.11SCF2714View
7Cranberry-Stevens-F1LG08N/A47.92SCF2714View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278602
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF2714.forward primerVaccinium macrocarponprimer
reverse primerSCF2714.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF2714SCF2714Vaccinium macrocarponmarker_locus
SCF2714SCF2714-60.93Vaccinium macrocarponmarker_locus
SCF2714SCF2714-50.11Vaccinium macrocarponmarker_locus
SCF2714SCF2714-47.92Vaccinium macrocarponmarker_locus