SCF27811, SCF27811 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF27811
Genbank IDKP278672
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)10
Primer 1SCF27811.forward primer: ATGTGACTAGCATGGGACTTA
Primer 2SCF27811.reverse primer: TATTTACCTGGATAGGAGAAGG
Max Length259
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG08N/A42.3SCF27811View
2Cranberry-Crimson_Queen-2007LG8N/A45.2SCF27811View
3Cranberry-CNJ02-1-2017LG08N/A46.8SCF27811View
4Cranberry-CNJ02-1-2007LG8N/A48.08SCF27811View
5Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG8N/A36.44SCF27811View
6Cranberry-[BG//BL/BN]95-F1LG08N/A44.76SCF27811View
7Cranberry-Composite_map-F1LG08N/A41.09SCF27811View
8Cranberry-Crimson_Queen-F1LG08N/A28.07SCF27811View
9Cranberry-Stevens-F1LG08N/A25.46SCF27811View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278672
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF27811.forward primerVaccinium macrocarponprimer
reverse primerSCF27811.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF27811SCF27811Vaccinium macrocarponmarker_locus
SCF27811SCF27811-44.76Vaccinium macrocarponmarker_locus
SCF27811SCF27811-41.09Vaccinium macrocarponmarker_locus
SCF27811SCF27811-28.07Vaccinium macrocarponmarker_locus
SCF27811SCF27811-25.46Vaccinium macrocarponmarker_locus